Jump to content
View in the app

A better way to browse. Learn more.
KH13 · for Kingdom Hearts

A full-screen app on your home screen with push notifications, badges and more.

To install this app on iOS and iPadOS
  1. Tap the Share icon in Safari
  2. Scroll the menu and tap Add to Home Screen.
  3. Tap Add in the top-right corner.
To install this app on Android
  1. Tap the 3-dot menu (⋮) in the top-right corner of the browser.
  2. Tap Add to Home screen or Install app.
  3. Confirm by tapping Install.

All Profile Comments

211,891 profile comments

  1. Demyx. posted a status update

    Keys is very intimidating.

    Weiss replied

    Rawr

    Demyx. replied

    D8

    Demyx. replied

    Run! Run away!

    OthersiderME replied

    RAWR. keys, capitals are more intimidating.

    Blake replied

    dammit xaon I was gong to say that D:

    Demyx. replied

    That's my job Ztar.

    Blake replied

    you're doing it well <3

    Demyx. replied
    <3
  2. Hei posted a status update

    ZTAR, I AM GONNA CALL THE INTERNET POLICE

    Blake replied

    D: NOOOOOO

  3. Kirie posted a status update

    you better watch out cuz im an alien c:

    bit replied

    ETPH

    Blake replied

    you said I was too :3

    OthersiderME replied

    i'm a mage

    Hei replied

    you better not take those majoras mask sheep

    bit replied

    Cow.

    Kirie replied

    Pff humans..

    Blake replied

    you said I wasn't :K

    bit replied

    Im a squirtle

    Hei replied

    I figured I'm like a space potato

    Cyber Shaman replied

    I'm a Shadow killing machine.

    bit replied

    ur more like a k3ybl4d3 khight

  4. teh lazy prince Xylek posted a status update

    Im going to name Xaons kid...Full Frontal!

  5. Weiss posted a status update

    OwO

  6. VanitasisKirby posted a status update

    I'm not nice. I'm scary 8D

    Weiss replied

    AHHHHHHH

    Pyrrha Nikos replied

    you're an Angel*

    Weiss replied

    *SCARY

    Pyrrha Nikos replied

    Angelic**

    Weiss replied

    *fear inducing angel

    VanitasisKirby replied

    I'm intimidating. xD

    let me hug you

    Pyrrha Nikos replied

    hugs of love c;

    Weiss replied

    *of death

    teh lazy prince Xylek replied

    im not scared of anyone...PLEASE DON'T HURT ME!

    Pyrrha Nikos replied

    Kirbs won't bite C;

    Weiss replied

    She won't bite but she will terrify you OwO

    Blake replied

    she has to perish....

    Demyx. replied

    Did someone say bite?

    VanitasisKirby replied

    I'll bite if I feel like it owo

    Blake replied
    ;)
    Pyrrha Nikos replied

    Kirby is still an Angel though cB

    Demyx. replied

    Do i have to do something bad to get bitten? o.O

    Blake replied

    yeah, Angel of Death

    Pyrrha Nikos replied

    Angel of sweetness actually c:

    Blake replied

    bullshit

    VanitasisKirby replied

    I'm not an angel. Thanks though <3

     

    @Xaon punch me and I'll bite you. owo I'll bite if I'm hungry

    Demyx. replied

    *lightly taps kibry with knuckles*

    Pyrrha Nikos replied

    YW ^^

     

    Who is this Kibry Xaon?

    Weiss replied

    Vani you're an angel. I'm terrifying though OwO

    Blake replied

    *pokes vani*

    VanitasisKirby replied

    Nooooo, not an angel. D:

    bites ztar and xaon

     

    rawr 83

    Blake replied

    bites where? ;)

    Weiss replied

    Yes, you are.

    Demyx. replied

    YESS!

    Pyrrha Nikos replied

    D:

    VanitasisKirby replied

    @Ztar Everywhere 8D

     

    what the heck

    how am I an angel O.O

    Blake replied

    that's hot

    Demyx. replied

    O.O

    VanitasisKirby replied

    just kidding.

    I only bite arms :3

    Demyx. replied

    Good enough for me :3

  7. Weiss posted a status update

    Vani is firetrucking scary

    Pyrrha Nikos replied

    That's something I never heard before o.o

    Blake replied

    I agree D:

    VanitasisKirby replied

    8D

    Weiss replied

    @Sil read the previous statuses

    @Ztar IKR? D:

    @Vani AHHHH

    Pyrrha Nikos replied

    She' a perfect angel in my book cB

    Blake replied

    AHHHHHHH RUN KEYS!!

    VanitasisKirby replied

    thank you sil :3

    GLOMPS EVERYONE

    Weiss replied

    *death glomps everyone

    OWO

    Pyrrha Nikos replied

    You're welcome ^^

     

    Blake replied

    she's going to glomp us to death.

     

    doesn't matter, got snoo snoo :P

  8. Col.Random left a comment on Shera Wizard's profile

    mission accomplished. Awwww yeah 8)

    Weiss replied

    You added 3 likes that weren't needed. xD I already had her back

  9. Blake posted a status update

    VanitasisKirby is terrifying imo.

    Queen Tery replied

    *Shivers*

    Hei replied

    Stop making me scared, I'll sue!!

    bit replied

    shh! can smell fear

    VanitasisKirby replied

    hai

    Blake replied

    AHHHHH! TAKE TREY NOT ME!! D:

    VanitasisKirby replied

    but trey doesn't have my phone :c

    give it baaaaack

    Weiss replied

    D:

    bit replied
    Blake replied

    I-I-I-I.....don't have....i-i-i-it.... D:

    VanitasisKirby replied

    IT'S IN YOUR HAND! D8<

    TACKLES

    Blake replied

    AHH

    *punches

    bit replied

    ITS A FAKE! Only I know where the real one is!

    Blake replied

    SEE, GO HILL HIM D:

     

    *runs

    bit replied

    its in ztars pants

    Blake replied

    jokes on you~~~

     

    I'm not even wearing pants >8D

    Hei replied

    PANTSLESS?!?!

    bit replied

    you burned them once you read my comment

    Blake replied

    yes hei, fear me >8)

     

    nu, I wasn't wearing them all day

    VanitasisKirby replied

    KICKS FIVE TIMES

    bit replied

    hehehehe..FOOLS.they will keep turning on each other and I will be the only one left and then I WILL BE THE RULER OF KH13 BWAHAHA

    Hei replied

    I DEFY YOU PANTSLESS MAN

    Blake replied

    VANI STAHP

    bit replied

    by day he's ordinary ztar but by night,he's PANTLESS MAN

    VanitasisKirby replied

    but I want my phone back D:

    Blake replied

    you're looking in the wrong place she-demon :L

    bit replied

    Oooooo... That was YOUR phone *walks away awkwardly*

    VanitasisKirby replied

    GAAUAUAUAUAUUAAAAAAUUUAAAA

    D8< KICKS

    Weiss replied

    *gets in the way of the kick*

    bit replied

    your a saint

    Blake replied

    off the hook!

     

    Hahaha~~

     

    *runs

  10. Cyber Shaman posted a status update

    UDATED: I find Koko, Deadshot, Protoman, Caity Raindrop, Flaming Lea, Sk3, No.i, and Kaiso intimidating.

    Weiss replied

    Why do you find Caity intimidating? Is it her awesomness? And Kaiso? Kaiso is quite nice. xD

    Cyber Shaman replied

    Kaiso is a powerful woman.

    Cyber Shaman replied

    You fluffy like a bear

    Blake replied

    VanitasisKirby is scurry as firetruck imo

    Queen Tery replied

    Kirby is absolutely terrifying. I once told her I'd get her a boat. She never let that shit go.

    Weiss replied

    I'm scared just saying the name.

    Cyber Shaman replied

    Yeah....I guess

    Ruby replied

    Wait why am I intimidating????

    Weiss replied

    Actually. Yeah. Why do you find I intimidating? O_O

    Blake replied

    you're too new to be threatening....

    Cyber Shaman replied

    One reason:

    Kh disscussions

    Blake replied

    so?

    I know what I'm talking about to >:W

    Ruby replied

    I'm confused too?? How did that make me intimidating???

    Cyber Shaman replied

    Figure that out. The answer is in front of you.

    Robbie the Wise replied

    Why is Caity Raindrop on this list she's very pleasant on forums o_O

    Weiss replied

    That's what I said.

    Robbie the Wise replied

    The only people on this list who I could see coming off as intimidating is Koko, Lea, and maybe Protoman.

    Blake replied

    ^ I'm with dev imo :/

    Weiss replied

    I think Koko could. Protoman is actually pretty nice if you know her. And Lea isn't too intimidating imo. o.o

    Blake replied

    well in a serious conversation, which is something I'm not too fond off xD

    Weiss replied
    xD
    Ruby replied

    Oh ok now I know why you think I'm intimidating...maybe??? Not so sure though if its because of the kh3d pros and cons thing

    Robbie the Wise replied

    Lea isn't once you get to know her but she has a strong personality which is intimidating to most people. Koko has a very strong set of beliefs and is very vocal about voicing them. Protoman....well you know.

    Weiss replied

    ^Pretty much that xD

    Cyber Shaman replied

    -Sigh-

    I know koko(Hinako ) and Protoman aka -ventus -

    proto is really nice yet she can be very blunt towards you stating anything stupid you do.

    she can be really nice yet that doesn't mean she neccessarly like you.

    She'll point out that you're being stupid, or if you're being annoying, or you're plain really cool.

    She's a troll. Lol

     

    Robbie the Wise replied

    So if you know them how do you find them intimidating.

    Cyber Shaman replied

    Koko is nice.

    She is straight forward but she is extremely blunt. She can make a total douche out of you if you don't watch out.

     

    Blake replied

    I made proto mad on purpose lol. she told me to get out xD

    Cyber Shaman replied

    I just said why.

    Cyber Shaman replied

    Read the post carefully.

    Weiss replied

    Even then ze isn't cruel. Ze will try to strongly make a point but not cruel. I guess it can sound mean at times but really Ze isn't cruel if you say something Ze doesn't like.

     

     

     

    Blake replied

    what If I can't read?

    Weiss replied
    xD
    Cyber Shaman replied

    Noo I'm talking about something like not respecting her opinions or really pissing her off.

    Cyber Shaman replied

    Lol but yeah you're right keys

    Blake replied

    dayum, this conversation is making me want to go purposely make someone mad....

    Weiss replied
    xD Good luck Ztar
    Cyber Shaman replied

    Caity because she has a really great personality, she's nice, smart, and as well as goddamn beautiful.

    She is very straight forward towards other people. She is intimidating for alot of reasons but her main one is probably what keys said earlier.

    Her awesomness xD

    Blake replied

    thx! its that perfect time of night where nothing can get to you :P

    Queen Tery replied

    My notifications... wtf guys

    Shana09 replied

    im intimidating right guys right?

    Robbie the Wise replied

    .......

    Weiss replied

    Sure, Shana. Just not as intimidating as Vanitasiskirby.

    Shana09 replied

    lame

    Cyber Shaman replied

    Nope you are almost as intimidating as Xoan

    Caity replied

    And you bloody well should (be intimidated of me).

    Cyber Shaman replied

    Lol

    Shana09 replied

    How am I on the level of Xaon

    Caity replied

    I am a goddess reincarnated. Everyone must bow down before me.

    Cyber Shaman replied

    Xaon is over 9000!

    You are 10,000.

    Weiss replied

    If Xaon is over 9000 does that make Vani over 1,000,000?

    Shana09 replied

    @Caity

     

    <--God

     

    @K3y

     

    atleast its not over 9000 xD

    Weiss replied

    Shana is a god.

    Cyber Shaman replied

    Caity is over a million.

    Keys is over 100,000

    Weiss replied

    VanitasisKirby must be like infinity or something.

    Cyber Shaman replied

    More like 5

    Weiss replied

    O.O

    Surprising.

    Caity replied

    Damn I'm legendary

    I don't understand the rating system though xD

    Weiss replied

    It's simple.

    Shana- God

    Caity- Legendary

    Trey- Awesome

    Me- Hedgehog

    Vani- Terrifying.

    Cyber Shaman replied

    Xoan -whore

    Cyber Shaman replied

    Xoan -Mon mon mon

    Weiss replied

    *Xaon xD

    Everyone misspells it lol

    Shana09 replied

    "Trey - Awesome"

     

     

    I disagree.

    Shana09 replied

    Xaon - Horny Spammer

    Ruby replied

    Wait so where does that make me since I'm apparently "intimidating" to you

    Cyber Shaman replied

    Xaon -Whore, horny spammer, mon mon mon, and over 90000

    Weiss replied

    @Shana I guess~

    @NO I

    No I- Imaginary number could be your rank OwO

    Cyber Shaman replied

    You're android 18

    Weiss replied
    xD
    Ruby replied

    O.O I have no idea what that means

    Queen Tery replied

    Shana is absolutely horrific.

    Shana09 replied

    you spelled terrific wrong

    Robbie the Wise replied

    This thing is still going on x_x

    Queen Tery replied

    Yes, this status must not die.

    Cyber Shaman replied

    I'm shanas slave

    Shana09 replied

    Yes you are, now go conjure a poisonous apple for Tery.

    Cyber Shaman replied

    Yes lord Shana domo kun judo no fratsu sama

     

    Cyber Shaman replied

    Yes it will.

    Queen Tery replied

    No

    Ruby replied

    Good then let's make it go to a 100

    Ruby replied

    You mean NOM NOM NOM!

    Queen Tery replied

    No, he means mon as in Digimon~

    Shana09 replied

    pokemonnnnnnnnnnnnnnnnnn

    Cyber Shaman replied

    DESU

    Caity replied

    I wanted to be 100th comment but no one else is commenting ):

    Queen Tery replied

    I can help with that~

    Cyber Shaman replied

    Hi caity!!!!

    Caity replied

    I'm to bed now (sleeping pills) so others will come and take my place D:

    Hello :3

    Ruby replied

    Goodnight Caity

    Cyber Shaman replied

    No one shall replace you!!!!

    Cyber Shaman replied
    <3
    Caity replied

    ** Divine Intervention **

    Cyber Shaman replied

    I'm Dirty Dan!

    Blake replied

    Who you calling Pinhead?

    Cyber Shaman replied

    LET'S go pinhead larry

    Weiss replied

    AHAHAHHAHAHAHAHAHAHAHA

    I CANT STOP LAUGHING xD

    Robbie the Wise replied

    Alright can we stop this already mah notifications

    Cyber Shaman replied

    Party time!!!

    Weiss replied

    Party time

    http://25.media.tumblr.com/tumblr_ltou4qDemy1r4fmxfo1_500.gif

    Cyber Shaman replied

    They call me magic mike

  11. goodman2008 posted a status update

    follow me on twitter https://twitter.com/goodman2008V2

  12. Shana09 posted a status update

    goodnighttttt 83

    Weiss replied

    Good night. :)

    Hope you're able to get some rest.

    VanitasisKirby replied

    Goodnight!

    I hope you're able to get some rest.

  13. Shana09 posted a status update

    I just saw a mouse sitting on the carpet @A@ and then it ran away when I yelled out "ITS THE MOUSE" (since my family wants it to get the hell out of the house) and then it ran away and came back 2 seconds later slowly. Its so cute :3

    Blake replied

    AWWWWWWWWWWWWWWWWWWWWw

    Shana09 replied

    They want to use a mouse trap but it kills me inside seeing a mouse in a trap.

    The last time we saw a mouse in a trap I always watched it and looked after it while dying inside. :<

  14. teh lazy prince Xylek posted a status update

    I don't know whos but i am going to name someones kid Full Frontal

    Hei replied

    It's like the perfect name for any kid!

  15. Koko posted a status update

    i found out that a kid from my school is a meme

    Shana09 replied

    which meme?

    Cyber Shaman replied

    Hahahahahahaha which meme?

    Koko replied

    look up moses garza the iii

    Cyber Shaman replied
    http://25.media.tumblr.com/tumblr_mce2u0tt9c1ryahxto1_400.png
    Hei replied

    what the hell kinda question is that

    Cyber Shaman replied

    Not sure....

    Shana09 replied

    ......

    what

    Protoman replied

    http://1.bp.blogspot.com/-QWIcxSbFH30/T_JGskb28NI/AAAAAAAAAuU/xu15Lyi6bLM/s1600/XFY8H%5B1%5D.png

    "xD Heil Hitler!"

    Cyber Shaman replied

    Oh found this too http://i.imgur.com/0HcSU.jpg

    Kinda messed up doncha say?: /

    Shana09 replied

    well

    he has to be kidding

    he gotta be

    Protoman replied

    http://mosesgarzaiii.blogspot.com

    bless /mu/

    Blake replied

    maybe.....just maybe.....

     

    that guy is a regular facebook idiot!

    Cyber Shaman replied
    http://25.media.tumblr.com/tumblr_m6hpncWQAA1qkv3fno1_500.png
    Hei replied

    http://2.bp.blogspot.com/-SI7nj6LUYoI/T9w5HYy2qYI/AAAAAAAAAps/-DobQYHOm6w/s1600/395533_198321563593619_1448558389_n.jpg

    The fear

    Koko replied

    he had to delete his facebook and everyone is really mean to him at school

    Cyber Shaman replied

    ...His Facebook stuff is still on Google images.

    Shit, he said some pretty messed up things.

    Shana09 replied

    this guy is meh

     

    but he is an idiot

    Cyber Shaman replied

    But I feel kinda bad for him.

    Hei replied

    That really does suck for him D:

    Protoman replied

    a lot of people get firetrucked over because internet

    so a good rule is to never piss off people on the internet

    Cyber Shaman replied

    *Cough *

    kingdom Hearts and anime forums are a exception.

     

     

    Cyber Shaman replied

    That's why I don't get a Facebook, but yeah you are sooo right Ventus.

  16. Anonn0000 left a comment on Queen Tery's profile

    Whats up?^^

    Queen Tery replied

    Not much. Just chatting with my girlfriend. You?

    Anonn0000 replied

    Just going around posting in da games lol. And thinking about riku being hugged. >w<;

    Queen Tery replied

    Hahaha Cool beans~

    Anonn0000 replied

    I wonder if Riku would like me to hug him so long as its gentally :)

    Shana09 replied

    i read "as its gentally" as.....not gonna even say it c:

    Queen Tery replied

    Of course YOU did~

    Anonn0000 replied

    Mmmmmn. I wouldn't mind doing that to him too *shot*

     

    ....I didn't say that. :P Actually, I did. Hahaha. And ment it too o-o;

    Shana09 replied

    so you knew what I meant right?

     

    @tery

     

    shut it I wasn't talking to you.

    Anonn0000 replied

    Yeah. I'm 22 years old now....so I don't really got any shame about it.....

     

    I think...

  17. 4Everbee posted a status update

    Mind: Don't hit send don';t do it don't you dare. Me:-hit send- Mind: WHAT DID YOU DO YOU DUMB firetruck! Me: SHITTTTTT Heart: JUST END IT NOW BURN ME BURN US JUST KILL US! Mind: OKAY OKAY OKAY I GOT A PLAN! Boobs: YEAH CAUSE YOUR PLANS ALWAYS WORK!!! Mind: SHUT UP YOUR JUST FAT!!! Me: I'M FAT?! Heart: NOW I'M HURT!!! Mind: NO BABE NO!!!! Boobs: nice job!

    OthersiderME replied

    did you just have an argument with various parts of yourself?

    4Everbee replied

    Pretty much C:

    Shana09 replied

    oh 4ever...

  18. Cyber Shaman left a comment on Sora96's profile

    DC never answered me but can i repost that image but dont add the khv link?

  19. Hei posted a status update

    Goku is summoning the SPIRIT FORK! Yes I am bored: http://oi45.tinypic.com/24wdp3l.jpg

    Cyber Shaman replied

    Eat the Spicy chicken!

    VanitasisKirby replied

    that is one smexy Spirit Fork xD

    Weiss replied

    POWERS

    Blake replied

    Goku is ready to take a bite out of evil! :D

    Cyber Shaman replied

    Ohh Chie-Chie is gonna get mad.

    She thought you like her forks Goku

    Hei replied

    Kakacarrot cake has the most powerful fork in silverware history

    Silent replied

    mm spicy chicken

    Blake replied

    YES!

    he will defeat the evil Vegatable! >:D

    Hei replied

    he will have to fight Vegatable and the mighty Broccoli! ...Radish

    Blake replied

    Vegata-table, and Nappa-melon

     

    :>

    Hei replied

    All those FOOD PUNS!

    Blake replied

    delicious right?

  20. Dave posted a status update

    I've eaten a river of liver and an ocean of fish!

    Daniel Black replied

    an alkaseltser and a draw of kefka would help?

     

    Dave replied

    Ooh, that would be very nice, indeed!

Configure browser push notifications
Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.
Scroll to the top